Review





Similar Products

98
New England Biolabs t3 5ʹaattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments
T3 5ʹaattaaccctcactaaaggg 3ʹ Promoter Tagged Pcr Fragments, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t3 5ʹaattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments/product/New England Biolabs
Average 98 stars, based on 1 article reviews
t3 5ʹaattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments - by Bioz Stars, 2026-04
98/100 stars
  Buy from Supplier

94
Integrated DNA Technologies t7 promoter
T7 Promoter, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t7 promoter/product/Integrated DNA Technologies
Average 94 stars, based on 1 article reviews
t7 promoter - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

98
New England Biolabs t3 5ʹ aattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments
T3 5ʹ Aattaaccctcactaaaggg 3ʹ Promoter Tagged Pcr Fragments, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t3 5ʹ aattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments/product/New England Biolabs
Average 98 stars, based on 1 article reviews
t3 5ʹ aattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments - by Bioz Stars, 2026-04
98/100 stars
  Buy from Supplier

97
New England Biolabs t7 rna polymerase promoter
T7 Rna Polymerase Promoter, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t7 rna polymerase promoter/product/New England Biolabs
Average 97 stars, based on 1 article reviews
t7 rna polymerase promoter - by Bioz Stars, 2026-04
97/100 stars
  Buy from Supplier

Image Search Results