|
New England Biolabs
t3 5ʹaattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments T3 5ʹaattaaccctcactaaaggg 3ʹ Promoter Tagged Pcr Fragments, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/t3 5ʹaattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments/product/New England Biolabs Average 98 stars, based on 1 article reviews
t3 5ʹaattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments - by Bioz Stars,
2026-04
98/100 stars
|
Buy from Supplier |
|
Integrated DNA Technologies
t7 promoter T7 Promoter, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/t7 promoter/product/Integrated DNA Technologies Average 94 stars, based on 1 article reviews
t7 promoter - by Bioz Stars,
2026-04
94/100 stars
|
Buy from Supplier |
|
New England Biolabs
t3 5ʹ aattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments T3 5ʹ Aattaaccctcactaaaggg 3ʹ Promoter Tagged Pcr Fragments, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/t3 5ʹ aattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments/product/New England Biolabs Average 98 stars, based on 1 article reviews
t3 5ʹ aattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments - by Bioz Stars,
2026-04
98/100 stars
|
Buy from Supplier |
|
New England Biolabs
t7 rna polymerase promoter T7 Rna Polymerase Promoter, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/t7 rna polymerase promoter/product/New England Biolabs Average 97 stars, based on 1 article reviews
t7 rna polymerase promoter - by Bioz Stars,
2026-04
97/100 stars
|
Buy from Supplier |